<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "https://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" 
         xmlns:mml="http://www.w3.org/1998/Math/MathML" 
         xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
         xmlns:ali="http://www.niso.org/schemas/ali/1.0/"
         article-type="research-article" 
         dtd-version="1.2" 
         xml:lang="en">
  <?properties manuscript?>
  <?origin nihpa?>
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">abc</journal-id>
      <journal-title-group>
        <journal-title>Archives of Breast Cancer</journal-title>
        <abbrev-journal-title abbrev-type="pubmed">Arch Breast Cancer</abbrev-journal-title>
      </journal-title-group>
      <issn publication-format="electronic">2383-0433</issn>
      <publisher>
        <publisher-name>Archives of Breast Cancer</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.32768/abc.2024114408-417</article-id>
      <article-id pub-id-type="manuscript">999</article-id>
      <article-version vocab="JAV" vocab-identifier="http://www.niso.org/publications/rp/RP-8-2008.pdf" 
        article-version-type="VoR" vocab-term="Version of Record">version-of-record</article-version>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Original Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Effects of Lupeol on Estrogen and Androgen Receptor-Positive Breast and Prostate Cancer Cells</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Majd</surname>
            <given-names>Mahdieh Nezami</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">a</xref>
        </contrib>
        <contrib contrib-type="author" corresp="yes">
          <name>
            <surname>Alizadeh</surname>
            <given-names>Arash</given-names>
          </name>
          <xref ref-type="aff" rid="aff2">b</xref>
          <xref ref-type="corresp" rid="cor1">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Hashem</surname>
            <given-names>Elham Zadeh</given-names>
          </name>
          <xref ref-type="aff" rid="aff2">b</xref>
        </contrib>
      </contrib-group>
      <aff id="aff1">
        <label>a</label>
        <institution>DVM Graduate Student, Faculty of Veterinary Medicine, Urmia University</institution>, <city>Urmia</city>, <country country="IR">Iran</country>
      </aff>
      <aff id="aff2">
        <label>b</label>
        <institution>Division of Pharmacology and Toxicology, Department of Basic Science, Faculty of Veterinary Medicine, Urmia University</institution>, <city>Urmia</city>, <country country="IR">Iran</country>
      </aff>
      <author-notes>
        <corresp id="cor1">
          <label>*</label>
          Address for correspondence: 
          <bold>Arash Alizadeh</bold>, 
          <institution>Division of Pharmacology and Toxicology, Department of Basic Science, Faculty of Veterinary Medicine, Urmia University</institution>, 
          <addr-line>Urmia</addr-line>, 
          <city>Urmia</city>, 
          <country>Iran</country>.
          E-mail: <email>dr.arash.alizadeh@gmail.com</email>
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors confirm that they have no conflicts of interest with respect to the work described in this manuscript.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>24</day>
        <month>09</month>
        <year>2024</year>
      </pub-date>
      <volume>11</volume>
      <issue>4</issue>
      <fpage>408</fpage>
      <lpage>417</lpage>
      <history>
        <date date-type="received" iso-8601-date="2024-07-23">
          <day>23</day>
          <month>07</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd" iso-8601-date="2024-09-21">
          <day>21</day>
          <month>09</month>
          <year>2024</year>
        </date>
        <date date-type="accepted" iso-8601-date="2024-09-24">
          <day>24</day>
          <month>09</month>
          <year>2024</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright &#x00A9; 2024 Archives of Breast Cancer</copyright-statement>
        <copyright-year>2024</copyright-year>
        <copyright-holder>Archives of Breast Cancer</copyright-holder>
        <license license-type="open-access">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution-Non-Commercial 4.0 International License, which permits copy and redistribution of the material in any medium or format or adapt, remix, transform, and build upon the material for any purpose, except for commercial purposes.</license-p>
          <ali:license_ref>https://creativecommons.org/licenses/by-nc/4.0/</ali:license_ref>
        </license>
      </permissions>
      <abstract>
        <title>Abstract</title>
        <sec>
          <title>Background</title>
          <p id="P1">Different reports have shown that prostate and breast cancers are the most common cancers worldwide. Lupeol, a dietary triterpene, provides various beneficial effects, including anti-cancer properties. The current study aims to investigate the anti-proliferative and antioxidant effects of lupeol, in line with the effects of lupeol on the expression of estrogen and androgen receptors in breast (MCF-7) and prostate (LNCaP) cancer cell lines.</p>
        </sec>
        <sec>
          <title>Methods</title>
          <p id="P2">MCF-7 and LNCaP cells were incubated with increasing concentrations of the lupeol (1, 10, and 100 µM) for 24 hours. The cytotoxicity of the lupeol was assessed by MTT and neutral red assays. Moreover, TAC (total antioxidant capacity) and gene expression of androgen and estrogen receptors were measured by spectrophotometric and qPCR methods, respectively. Overall, 17 beta-estradiol (E2) (9 nM) and dehydroepiandrosterone (DHEA) (5 µM) were selected as positive controls.</p>
        </sec>
        <sec>
          <title>Result</title>
          <p id="P3">The highest concentration of the lupeol induced cytotoxic effects on MCF-7 and LNCaP cells. Various levels of lupeol at specified time intervals increased TAC levels in comparison with the control group. Moreover, the expression levels of estrogen receptors (α and β) and androgen receptors were negatively affected by lupeol.</p>
        </sec>
        <sec>
          <title>Conclusion</title>
          <p id="P4">The findings of our study indicate that lupeol could serve as a promising and accessible multi-functional anti-tumor agent against hormone-positive breast and prostate cancers.</p>
        </sec>
      </abstract>
      <kwd-group>
        <title>Keywords</title>
        <kwd>lupeol</kwd>
        <kwd>MCF-7</kwd>
        <kwd>LNCaP</kwd>
        <kwd>estrogen receptors</kwd>
        <kwd>androgen receptor</kwd>
        <kwd>antioxidant capacity</kwd>
      </kwd-group>
      <funding-group>
        <funding-statement>No specific grant from funding agencies in the public, commercial, or not-for-profit sectors was received for this study.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="intro" id="S1">
      <title>Introduction</title>
      <p id="P5">Epidemiological data suggested that triterpene-enriched diets could show beneficial effects on sex hormone-dependent cancers, including breast,  prostate, ovarian, and endometrial cancers.<xref rid="R1" ref-type="bibr">1</xref> Lupeol (Lpl) is a multi-source natural triterpene gaining more and more attention nowadays, due to its beneficial effects on different conditions such as infectious diseases, renal, cardiovascular, and inflammatory disorders, diabetes, hepatic toxicity, microbial arthritis, and cancer.<xref rid="R2" ref-type="bibr">2</xref> Cancer, as one of the most aggressive diseases and the second cause of mortality, is a hyperproliferative disorder that involves various circumstances, including transformation, dysregulation of apoptosis, proliferation, invasion, angiogenesis, and metastasis.<xref rid="R3" ref-type="bibr">3</xref>,<xref rid="R4" ref-type="bibr">4</xref></p>
      <p id="P6">It has been revealed that Lpl can act as a sensitizer and chemotherapeutic agent in combination with conventional anti-neoplastic medicine through its modulatory effects on pivotal signaling pathways in cancer etiology and progression, such as the PI3K/AKT/mTOR and nuclear factor kappa B (NF-κB), downregulation of Bcl-2 and Bcl-Xl, MMP-9, as well as upregulation of caspase-3 that leads to apoptosis of apoptosis.<xref rid="R5" ref-type="bibr">5</xref>–<xref rid="R7" ref-type="bibr">7</xref> Lpl has the potency to induce G2/M cell cycle arrest by inhibiting the cyclin-regulated signaling pathway in cancer cells.<xref rid="R8" ref-type="bibr">8</xref> The structural similarity of Lpl with androgenic hormones makes it a potential candidate for modulating the androgen receptor signaling cascade.<xref rid="R9" ref-type="bibr">9</xref> Previous investigations indicated different characteristics for Lpl, including inhibition of cell migration, decrease of cell proliferation, and induction of apoptosis.<xref rid="R10" ref-type="bibr">10</xref> In addition, other mechanisms such as chemosensitization of tumor cells and inhibition of androgen receptor have also been reported as possible mechanisms of action for Lpl.<xref rid="R10" ref-type="bibr">10</xref></p>
      <p id="P7">The estrogen effects are associated with binding to the ERs: estrogen receptor alpha (ERα) and estrogen receptor beta (ERβ), while the stimulation or inhibition of the underlined signaling pathway in the target organ depends on the balance between ERα and ERβ activities.<xref rid="R13" ref-type="bibr">13</xref> Based on previous investigations, ERα is a transcriptional factor expressed in more than 70 percent of breast cancer patients and induces the proliferation of breast cancer cells.<xref rid="R14" ref-type="bibr">14</xref> but there is limited information about the role of ERβ in the treatment and biology of breast cancer.<xref rid="R15" ref-type="bibr">15</xref></p>
      <p id="P8">Concerning prostate cancer, epidemiological studies have shown that the incidence and mortality of prostate cancer are among the top 5 important malignancies on a worldwide scale.<xref rid="R16" ref-type="bibr">16</xref> Due to the fact that the androgen receptor plays an important role in the progression of prostate cancer; therefore, successful treatment can be achieved by the modulation of the androgen receptor and associated pathways.<xref rid="R17" ref-type="bibr">17</xref></p>
      <p id="P9">Various limitations have been documented concerning the standard therapeutic protocols in cancer therapy, such as surgery, chemotherapy, radiation, immune therapy, targeted therapy, and hormone therapy.<xref rid="R18" ref-type="bibr">18</xref></p>
      <p id="P10">Herbal medicines and nature-based medicinal approaches have provided a significant opportunity for the improvement of the applied treatment protocols because of broader beneficial effects with limited side effects in the prevention and treatment of cancer.<xref rid="R19" ref-type="bibr">19</xref>,<xref rid="R20" ref-type="bibr">20</xref></p>
      <p id="P11">Therefore, the purpose of this study was to investigate the antiproliferative, antioxidant, and pro-apoptotic effects of Lpl on two distinct types of cancer cells (MCF-7 as the ER-positive human breast cancer cell line and LNCaP as the androgen-sensitive human prostate adenocarcinoma cell line). Moreover, the possible effect of Lpl on gene expression of estrogen and androgen receptors was evaluated to open new venues in cancer therapy and improve the quality of life in cancer patients.</p>
    </sec>
    <sec sec-type="methods" id="S2">
      <title>Methods</title>
      <sec id="S2-1">
        <title>Cell culture</title>
        <p id="P12">This is an in vitro study on MCF-7 cells, as the ER-positive human breast cancer cell line, and LNCaP cells, as the androgen-sensitive human prostate adenocarcinoma cell line, were seeded in DMEM (Dulbecco's Modified Eagle Medium) and RPMI 1640 (Roswell Park Memorial Institute Medium) (Sigma-Aldrich, St. Louis, MO, USA), respectively. Both of the cell culture media were supplemented with 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin-streptomycin (100 IU/mL and 100 μg/mL). The cells were kept in a 5% CO2 and 37 °C incubator as optimal conditions. The subculture of the cells was performed after reaching 70% to 80% confluency according to the standard protocols.<xref rid="R21" ref-type="bibr">21</xref> Cytotoxicity evaluations were conducted in 96-well plates with optimal density based on previous studies, while the samples for qPCR analysis were prepared by seeding the cells in 6-well plates. Lpl (L 5632) was purchased from Sigma (Sigma-Aldrich, St. Louis, MO, USA) and the stock solution was prepared with dimethyl sulfoxide (DMSO, Merck, Germany) while the final concentrations of Lpl (1, 10 and 100 μM) were used as experimental concentrations, and untreated cells were utilized as control cells (0.5% DMSO).  Dehydroepiandrosterone (DHEA, D 4000) 5 µM and 17 beta-estradiol (E2) 9 nM (Sigma-Aldrich, St. Louis, MO, USA) were utilized as associated controls, and the stock solutions were prepared in DMSO.</p>
      </sec>
      <sec id="S2-2">
        <title>Cytotoxicity assays (MTT)</title>
        <p id="P13">Cell viability was quantified by the colorimetric MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. MTT assay is based on the assessment of the capacity of living cells to reduce the yellow water-soluble substrate tetrazolium salt into a purple water-insoluble formazan product, which is considered an indicator of cell viability (22). MCF-7 and LNCaP cells were treated in 96-well plates (5×103 cells/well) with DMEM and RPMI culture medium, respectively. To this end, the cells were exposed to different concentrations of Lpl (1, 10, and 100 µM), DHEA (5 µM), and 17β-estradiol (9 nM) for 24, 48, and 72 hours. All the procedures were conducted based on the protocol of previous studies.<xref rid="R23" ref-type="bibr">23</xref> Cell viability percentage was calculated by the following formula:</p>
        <disp-formula id="E1">
          <label>(1)</label>
          <tex-math id="M1"><![CDATA[
\documentclass{article}
\usepackage{amsmath}
\begin{document}
\begin{equation*}
\mbox{Cell viability (\\%)} = \frac{\mbox{(Mean OD (sample))}}{\mbox{(Mean OD (blank))}} \times 100
\end{equation*}
\end{document}
]]></tex-math>
        </disp-formula>
      </sec>
      <sec id="S2-3">
        <title>Neutral red (NRU) assay</title>
        <p id="P14">Neutral red is a vital dye, which is preferentially absorbed and endocytosed by viable cells and internalized inside the lysosome; therefore, it can be considered as an indicator of lysosome and cell integrity.<xref rid="R22" ref-type="bibr">22</xref> MCF-7 and LNCaP cells were treated in 96-well plates (5×103 cells/well) containing 100μl of DMEM and RPMI medium, respectively, by a concentration range of 1 to 100 μM of Lpl, 5 µM of DHEA, and 9 nM of E2 for 24, 48, and 72 hours. Then, 5 μL of Neutral red solution (4mg/ml) was added to the cells for 3 hours based on the previous protocol. As the final step, the absorbance was recorded at 540 nm.</p>
      </sec>
      <sec id="S2-4">
        <title>Total antioxidant capacity assay</title>
        <p id="P15">Total antioxidant capacity (TAC) was assessed in the supernatant of MCF-7 and LNCaP cells with different concentrations of Lpl (1, 10, and 100 μM) at time points of 24, 48, and 72 hours by the method described by Koracevic et al.<xref rid="R24" ref-type="bibr">24</xref> In brief, 490 μL of PBS solution was added to 10 μL of the sample. Additionally, sodium benzoate, acetic acid, Fe-EDTA, and H2O2 were added to the tubes, respectively. The tubes were then immersed at 37 °C for 60 minutes, and finally, after adding the thiobarbituric acid solution and placing the tubes in boiling water (10 minutes), the absorption of the samples was read at 532nm. A suitable solution (FeSO4.7H2O) of Fe2+ and ascorbic acid was used as a blank and standard solution.</p>
      </sec>
      <sec id="S2-5">
        <title>RNA isolation and cDNA synthesis</title>
        <p id="P16">The RNA isolation was performed by the standard TRIzol method.<xref rid="R25" ref-type="bibr">25</xref> The RNA amount was determined spectrophotometrically, and RNA purity was determined by NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA) with expected values between 1.8 and 2. The samples were stored at −70°C for cDNA synthesis. The 20-µL reaction mixture containing l µL RNA, 10 μL 2 × reaction buffers, 2 μL enzyme mix, and 7 μL RNase-Free water was prepared according to the instructions of Pars Tools Company. The cycling protocol for the 20μL reaction mixture was 10 minutes at 25 °C, followed by 60 minutes at 47 °C, and 5 minutes at 85 °C to terminate the reaction.</p>
      </sec>
      <sec id="S2-6">
        <title>Real-time polymerase chain reaction</title>
        <p id="P17">The PCR reaction was carried out in a total volume of 20 μL, containing PCR master mix (10 μL, FWD and REV specific primers (each 1 μL), and cDNA as a template (1 μL) and nuclease-free water (7 μL). PCR conditions were run as follows: denaturation at 95 °C for 10 minutes, 1 cycle, followed by 45 cycles at 95 °C for 20 seconds. The annealing temperature (45 to 65 °C) was 20 to 40 seconds, while elongation was 72 °C for 30 seconds and 72 °C for 10 minutes. Data were analyzed using the ∆∆Ct method, and expression values were normalized to the expression levels of the β-actin gene. Primer pairs for real-time PCR are depicted in Table 1.</p>
        <table-wrap id="T1" position="float">
          <label>Table 1</label>
          <caption>
            <p>Pairs of Real-Time Polymerase Chain Reaction Primers.</p>
          </caption>
          <table>
            <thead>
              <tr>
                <th align="left">Target genes</th>
                <th align="left">Primer sequences</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td align="left">Androgen receptor</td>
                <td align="left">F: CTGGCTTCCGCAACTTACAC&#x0009;R: TCATTCGGACACACTGGCT</td>
              </tr>
              <tr>
                <td align="left">ERα</td>
                <td align="left">F: TCCTGATGATTGGTCTCGTCT&#x0009;R: TCTGGAAGAGAAGGAACCATATCC</td>
              </tr>
              <tr>
                <td align="left">ERß</td>
                <td align="left">F: GCTCAATTCCAGTATGTACC&#x0009;R: GGACCACATTTTTGCACT</td>
              </tr>
              <tr>
                <td align="left">ß-actin</td>
                <td align="left">F: CTGGAACGGTGAAGGTGACA&#x0009;R: TGGGGTGGCTTTTAGGATGG</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="S2-7">
        <title>Statistical analysis</title>
        <p id="P18">For statistical analyses, the mean and standard deviation of the measured parameters were calculated. All data are reported as the mean  SD of triplicate experiments. The results were analyzed using GraphPad Prism software (version 8.02, GraphPad Software Inc., San Diego, California, USA). The comparisons between groups were made by analysis of variance (one-way ANOVA) followed by the Bonferroni post hoc test. The significant difference between the control and the treatment group is marked with an asterisk symbol () in the results section. A P-value less than 0.05 was considered significant.</p>
      </sec>
    </sec>
    <sec sec-type="results" id="S3">
      <title>Results</title>
      <sec id="S3-1">
        <title>Cell viability</title>
        <p id="P19">The MTT method was used to evaluate the effects of Lpl with increasing concentrations on breast (MCF-7) and prostate (LNCaP) cancer cell viability. The results of the MTT test showed that 100 μM Lpl significantly reduced the cell viability starting from 24-hour incubation and lasting for 72 hours (P&lt;0.05). It should be noted that the decrease in the survival of LNCaP cells with the highest concentration of Lpl was not statistically significant at a 24-hour incubation period, but longer exposure resulted in a significant decrease in cell viability. As depicted in Figure 1, the control treatments with DHEA and E2 have shown no effect on cell viability.</p>
        <fig id="F1" position="float">
          <label>Figure 1</label>
          <caption>
            <p>LNCaP and MCF-7 cells’ viability, exposed to different concentrations of Lupeol (1, 10, and 100 μM), based on the MTT test assay. *P≤0.05, ***P≤0.01</p>
          </caption>
          <graphic xlink:href="2383-0433-11-04-408-g001.eps">
            <alt-text>Figure 1</alt-text>
          </graphic>
        </fig>
      </sec>
      <sec id="S3-2">
        <title>Neutral red</title>
        <p id="P20">The NR method was used to evaluate the effects of Lpl with increasing concentrations on survival and Lysozyme activity of breast (MCF-7) and prostate (LNCaP) cancer cells. For this purpose, the cells were exposed to different concentrations of Lpl as well as single concentrations of E2 and DHEA for 24, 48, and 72 hours. As shown in Figure 2, the highest concentration of Lpl in MCF-7 cells after 24 hours showed a significant effect (P&lt;0.05).</p>
        <fig id="F2" position="float">
          <label>Figure 2</label>
          <caption>
            <p>LNCaP and MCF-7 Lysosomal Enzyme Activity Exposed to Different Concentrations of Lupeol (1, 10, and 100 μM) According to the Neutral Red Assay. *P≤0.05</p>
          </caption>
          <graphic xlink:href="2383-0433-11-04-408-g002.eps">
            <alt-text>Figure 2</alt-text>
          </graphic>
        </fig>
      </sec>
      <sec id="S3-3">
        <title>Cell morphology of LNCaP cells</title>
        <p id="P21">As shown in Figure 3, the morphology of LNCaP cells following 24h  incubation with E2,  DHEA,  and various concentrations of Lpl show significant changes in the highest Lpl concentration.</p>
        <fig id="F3" position="float">
          <label>Figure 3</label>
          <caption>
            <p>Morphology of LNCaP Cells Exposed to Different Concentrations of Lupeol. DHEA, dehydroepiandrosterone; E2, estradiol; Lpl, lupeol.</p>
          </caption>
          <graphic xlink:href="2383-0433-11-04-408-g003.tif">
            <alt-text>Figure 3</alt-text>
          </graphic>
        </fig>
      </sec>
      <sec id="S3-4">
        <title>Cell morphology of MCF-7 cells</title>
        <p id="P22">As shown in Figure 4, the morphology of MCF-7 cells following 24 hours of incubation with E2, DHEA, and different concentrations of Lpl shows significant changes in the DHEA group and the highest Lpl concentration.</p>
        <fig id="F4" position="float">
          <label>Figure 4</label>
          <caption>
            <p>Morphology of MCF-7 Cells Exposed to Different Concentrations of Lupeol</p>
          </caption>
          <graphic xlink:href="2383-0433-11-04-408-g004.tif">
            <alt-text>Figure 4</alt-text>
          </graphic>
        </fig>
      </sec>
      <sec id="S3-5">
        <title>Total antioxidant capacity assay</title>
        <p id="P23">Table 2 shows the results of the TAC assay in MCF-7 and LNCaP cells. Compared to the control group, 1 μM and 10 μM of Lpl after 24, 48, and 72 hours and 100 μM of Lpl after 48 hours, in MCF-7 cells, and 1 μM and 10 μM of Lpl after 48 and 72 hours, and  100 μM of Lpl after 72 hours, in LNCaP cells, increased TAC level. The mean OD was measured at 532 nm using a spectrophotometer. Both E2 and DHEA increased TAC compared to the control group in 48 and 72 hours of treatment (P&lt;0.05).</p>
        <table-wrap id="T2" position="float">
          <label>Table 2</label>
          <caption>
            <p>Total Antioxidant Capacity in Different Study Groups at 24, 48, and 72 Hours</p>
          </caption>
          <table>
            <thead>
              <tr>
                <th rowspan="2" align="left">Time Groups</th>
                <th colspan="2" align="center">24h</th>
                <th colspan="2" align="center">48h</th>
                <th colspan="2" align="center">72h</th>
              </tr>
              <tr>
                <th align="center">MCF-7</th>
                <th align="center">LNCaP</th>
                <th align="center">MCF-7</th>
                <th align="center">LNCaP</th>
                <th align="center">MCF-7</th>
                <th align="center">LNCaP</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td align="left">Control</td>
                <td align="center">0.376 ± 0.019</td>
                <td align="center">0.557 ± 0.073</td>
                <td align="center">0.188 ± 0.010</td>
                <td align="center">0.319 ± 0.019</td>
                <td align="center">0.471 ± 0.016</td>
                <td align="center">0.345 ± 0.008</td>
              </tr>
              <tr>
                <td align="left">E2</td>
                <td align="center">0.336 ± 0.016</td>
                <td align="center">0.693 ± 0.004</td>
                <td align="center">0.860***  ± 0.077</td>
                <td align="center">0.546*** ± 0.017</td>
                <td align="center">0.822*** ± 0.051</td>
                <td align="center">0.900*** ± 0.038</td>
              </tr>
              <tr>
                <td align="left">DHEA</td>
                <td align="center">0.458*** ± 0.017</td>
                <td align="center">0.584 ± 0.109</td>
                <td align="center">0.533***  ± 0.013</td>
                <td align="center">0.439* ± 0.021</td>
                <td align="center">0.851*** ± 0.043</td>
                <td align="center">0.804*** ± 0.091</td>
              </tr>
              <tr>
                <td align="left">Lpl 1µM</td>
                <td align="center">0.508*** ± 0.004</td>
                <td align="center">0.614 ± 0.094</td>
                <td align="center">0.695***  ± 0.012</td>
                <td align="center">0.456** ± 0.015</td>
                <td align="center">0.875*** ± 0.022</td>
                <td align="center">0.867*** ± 0.055</td>
              </tr>
              <tr>
                <td align="left">Lpl 10µM</td>
                <td align="center">0.478*** ± 0.010</td>
                <td align="center">0.743* ± 0.014</td>
                <td align="center">0.611***  ± 0.025</td>
                <td align="center">0.513*** ± 0.037</td>
                <td align="center">0.744*** ± 0.077</td>
                <td align="center">0.898*** ± 0.008</td>
              </tr>
              <tr>
                <td align="left">Lpl 100µM</td>
                <td align="center">0.307 ± 0.003</td>
                <td align="center">0.544 ± 0.080</td>
                <td align="center">0.463***  ± 0.022</td>
                <td align="center">0.373 ± 0.077</td>
                <td align="center">0.418 ± 0.071</td>
                <td align="center">0.515** ± 0.060</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn id="TFN1">
              <p>LNCaP and MCF-7 cells exposed to different concentrations of Lupeol (1, 10, 100 μM), and the total antioxidant capacity was evaluated in the supernatant of the treated cells. *P≤0.05, **P≤0.01, ***P≤0.001. DHEA, dehydroepiandrosterone; E2, estradiol; Lpl, lupeol.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
      <sec id="S3-6">
        <title>qPCR</title>
        <p id="P24">qPCR analysis was used to evaluate the gene expression levels of the androgen receptor and alpha and beta estrogen receptors. As shown in Figure 5, the expression of alpha estrogen receptor genes at concentrations of 10 μM and 100 μM of Lpl was significantly reduced compared to the control group, but the decreasing effects of beta estrogen receptor gene expression were observed at 1 μM and 10 μM Lpl.</p>
        <fig id="F5" position="float">
          <label>Figure 5</label>
          <caption>
            <p>Effect of lupeol on gene expression of alpha and beta estrogen receptors relative to the ß-actin reference gene in MCF-7 cells. *P≤0.05, **P≤0.01, ***P≤0.001.</p>
          </caption>
          <graphic xlink:href="2383-0433-11-04-408-g005.eps">
            <alt-text>Figure 5</alt-text>
          </graphic>
        </fig>
        <p id="P25">It should be noted that DHEA (5µM) induced a decrease in gene expression levels of both receptors compared to the control group (P &lt; 0.05).</p>
        <p id="P26">As shown in Figure 6, the gene expression of androgen receptor at concentrations of 1 μM and 10 μM of Lpl was significantly reduced compared to the control group. However, DHEA showed decreasing effects and E2 showed increasing effects on the gene expression of the androgen receptor compared to the control group.</p>
        <fig id="F6" position="float">
          <label>Figure 6</label>
          <caption>
            <p>Effect of Lupeol on Gene Expression of Androgen Receptors Relative to the ß-Actin Reference Gene in LNCaP cells. *P≤0.05, **P≤0.01, ***P≤0.001.</p>
          </caption>
          <graphic xlink:href="2383-0433-11-04-408-g006.eps">
            <alt-text>Figure 6</alt-text>
          </graphic>
        </fig>
      </sec>
    </sec>
    <sec sec-type="discussion" id="S4">
      <title>Discussion</title>
      <p id="P27">Breast and prostate cancers, as hormone-dependent tumors, are the most common malignancies in women and men, respectively.<xref rid="R26" ref-type="bibr">26</xref>,<xref rid="R27" ref-type="bibr">27</xref> In men and women, increased levels of androgens/estrogens and mutations in their receptors have been shown to increase the risk of prostate and breast hormone-positive (HR+) cancers, respectively.<xref rid="R28" ref-type="bibr">28</xref>,<xref rid="R29" ref-type="bibr">29</xref></p>
      <p id="P28">The current study was set up to investigate the cytotoxic effects of Lpl on MCF-7 cells as a human breast cancer cellular model with estrogen receptors, and LNCaP cells as an androgen-sensitive human prostate adenocarcinoma cellular model. Then, the effects of Lpl on estrogen and androgen receptor expressions and the antioxidant capacity of Lpl-exposed cells were evaluated to shed more light on the potential beneficial effects of Lpl.</p>
      <p id="P29">The obtained results from the MTT assay showed that Lpl can reduce cell viability at the highest concentration (100 μM) in MCF-7 and LNCaP cell lines after 24, 48, and 72 hours. These results are in line with findings from a study by Pitchai et al.<xref rid="R7" ref-type="bibr">7</xref> which showed that Lpl isolated from Elephantopus scaber plant has the ability to reduce the viability of MCF-7 cells with an IC50 value of  80μM.</p>
      <p id="P30">The results from the NR assay in the current study were not identical in association with time and concentrations. Results from a previous study that investigated the effect of betulinic acid (BA) and oleanolic acid (OA) as triterpenoids on the function and morphology of mitochondria and lysosomes in human skin keratinocyte (HaCaT) cells showed that despite the structural similarity of these triterpenoid compounds, betulinic acid was capable of damaging lysosomal and mitochondrial membranes but oleanolic acid was not capable of this function. This different function of these triterpenoids that was observed in this study can be related to the specific structure–activity relationships of these two compounds.<xref rid="R30" ref-type="bibr">30</xref> It seems that the chemical structure of Lpl as a triterpenoid compound can be an important factor concerning the NR results.</p>
      <p id="P31">The current investigation demonstrated that Lpl has the ability to considerably alter the total antioxidant capacity (TAC) in a time- and dose-dependent manner in MCF-7 and LNCaP cell lines, so that at 1 and 10 µM concentrations it increases the TAC, but decreases the TAC at 100 µM concentration. Analysis of the ethanolic extraction of the Ficus pseudopalma plant showed that the plant contains significant amounts of Lpl with antioxidant properties.<xref rid="R31" ref-type="bibr">31</xref> It has been reported that the antioxidant capacity of Lpl can be related to the free radicals/ROS species-scavenging activity and lipid peroxidation inhibitory effects of Lpl addressed by studies utilizing DPPH and ABTS assays.<xref rid="R32" ref-type="bibr">32</xref>,<xref rid="R33" ref-type="bibr">33</xref> Moreover, DHEA and E2 in the present study, which were used to affect androgen and estrogen receptors, also showed the ability to increase total antioxidant capacity (TAC) levels in sample supernatants at time points of 48 and 72 hours.  The results are in line with previous studies confirming the ability of DHEA and E2 to inhibit oxidative-stress responses and modulate the redox balance.<xref rid="R34" ref-type="bibr">34</xref>,<xref rid="R35" ref-type="bibr">35</xref></p>
      <p id="P32">A study by Ding et al.<xref rid="R36" ref-type="bibr">36</xref> showed that pretreatment of Leydig cells isolated from rats with DHEA could reduce oxidative stress and DNA injury induced by hydrogen peroxide (H2O2). In another study using mouse decidual endometrial stromal cells (ESCs), DHEA showed the potency to reduce intracellular reactive oxygen species (ROS) levels in a dose-dependent manner.<xref rid="R34" ref-type="bibr">34</xref> Considering the ameliorative effects of E2 on TAC levels in sample supernatants, the results of the current study are in agreement with the results from investigations using  E2 in colon epithelial cells (CCD841CoN cells), where E2 at a dose of 8 nM could induce antioxidant enzymes including heme oxygenase-1 (HO-1) and NAD(P)H-quinone oxidoreductase-1 (NQO-1).<xref rid="R37" ref-type="bibr">37</xref>  It should be noted that E2 has the key role in the augmentation of antioxidant capacity via activation of the Nrf2 signaling pathway.<xref rid="R38" ref-type="bibr">38</xref></p>
      <p id="P33">In general, similar to drugs such as tamoxifen, phytoestrogenic bioactive compounds may act as selective estrogen receptor modulators (SERMs), exhibiting estrogen agonist or antagonist effects in a dose and target organ tissue-dependent manner through changes in the expression of particular co-activators or co-repressors of ERα and ERβ activity.<xref rid="R39" ref-type="bibr">39</xref>,<xref rid="R40" ref-type="bibr">40</xref> In this regard, a study by Thongon et al.<xref rid="R41" ref-type="bibr">41</xref> indicated that phytoestrogenic extract obtained from Curcuma comosa plant had estrogenic activity at low doses (0.1–1 μM) and anti-estrogenic activity at high doses (10–50 μM) on HEK-293T cells while showing antagonistic effects on estrogen receptors in MCF-7 cells. In an in vitro study, results of gene expression analysis indicated that Lpl could induce the expression of endogenous estrogen receptor at a concentration of 1μM in a way that the effects on ERβ were more pronounced than those on ERα. However, Lpl alone (10−9 and 10−8μM) has been shown to serve as an antagonist in HEK293T‐Erα.<xref rid="R42" ref-type="bibr">42</xref> Interestingly, co-administration of Lpl with an estrogen receptor antagonist (fulvestrant) resulted in the Lpl-effect as an estrogen agonist in the tissue of vagina.<xref rid="R38" ref-type="bibr">38</xref></p>
      <p id="P34">The results of the present study showed that Lpl at high concentrations (10 and 100μM) has a decreasing effect on ERα expression levels, which is in line with previous reports.<xref rid="R42" ref-type="bibr">42</xref> It is known that DHEA and metabolites could act as ligands for estrogen and androgen receptors.<xref rid="R43" ref-type="bibr">43</xref> On the other hand, based on the function of aromatase enzymes, androgens can be converted to estrogens, which can also affect estrogen receptors. Therefore, under certain circumstances, they can produce more estrogens (E2) as well as estrogenic effects.<xref rid="R44" ref-type="bibr">44</xref></p>
      <p id="P35">In the present study, the gene expression analysis showed that Lpl acts as an anti-androgen on the androgen receptor. Based on the structural similarity of Lpl with androgens and its interactions with androgen receptor signaling function through competitive antagonism and reducing the expression level of prostate-specific antigen (PSA) as an androgen receptor target, it can be concluded that a decrease in androgen receptor transcription is inevitable.<xref rid="R9" ref-type="bibr">9</xref>,<xref rid="R45" ref-type="bibr">45</xref></p>
      <p id="P36">The microscopic images of MCF-7 and LNCaP cells demonstrated that the highest concentration of Lpl (100 μM) after 24 hours damages the cells. These results are in line with the findings of previous studies that have examined the cytotoxic effects of Lpl derived from different natural sources on different cell lines where the cytotoxic effects of Lpl on cancer cells were documented in changes in the expression of proteins involved in cell cycle (cyclin proteins and cyclin-dependent kinases), apoptosis, autophagy and epithelial–mesenchymal transition (EMT) processes.<xref rid="R46" ref-type="bibr">46</xref>–<xref rid="R48" ref-type="bibr">48</xref></p>
    </sec>
    <sec sec-type="conclusions" id="S5">
      <title>Conclusion</title>
      <p id="P37">Based on the results obtained from this study, it can be concluded that Lpl has significant effects on the cell viability of ER-positive breast (MCF-7) and AR-positive prostate (LNCaP) cancer cells. Furthermore, Lpl exerted inhibitory effects on the expression levels of androgen and estrogen receptors, which might be an important factor in the development of cancer cells. In addition to these effects, evaluating the TAC induced by Lpl can account for the complementary beneficial effects of Lpl in cancer patients. The findings of our study indicate that Lpl could serve as a promising and accessible multi-functional anti-tumor agent against hormone-positive breast and prostate cancers. Further studies are warranted to unravel the detailed mechanism of action behind the beneficial effects of Lpl.</p>
    </sec>
    <sec id="S6">
      <title>Ethical considerations</title>
      <p id="P38">Not applicable.</p>
    </sec>
  </body>
  <back>
    <ack>
      <p id="P39">The Research Deputy of Urmia University funded the present experiment. We are grateful to Dr Hassan Malekinezhad for his kind assistance during the experiment.</p>
    </ack>
    <sec sec-type="data-availability">
      <title>Data availability</title>
      <p id="P40">The data used in the current study are available from the corresponding author upon reasonable request.</p>
    </sec>
    <ref-list>
      <title>References</title>
      <ref id="R1">
        <label>1</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Şoica</surname><given-names>C</given-names></name>
            <name><surname>Voicu</surname><given-names>M</given-names></name>
            <name><surname>Ghiulai</surname><given-names>R</given-names></name>
            <name><surname>Dehelean</surname><given-names>C</given-names></name>
            <name><surname>Racoviceanu</surname><given-names>R</given-names></name>
            <name><surname>Trandafirescu</surname><given-names>C</given-names></name>
            <etal/>
          </person-group>
          <article-title>Natural compounds in sex hormone-dependent cancers: The role of triterpenes as therapeutic agents</article-title>.
          <source>Front Endocrinol (Lausanne)</source>.
          <year>2021</year>;<volume>11</volume>:<fpage>612396</fpage>
          <pub-id pub-id-type="doi">10.3389/fendo.2020.612396</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R2">
        <label>2</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Siddique</surname><given-names>HR</given-names></name>
            <name><surname>Saleem</surname><given-names>M</given-names></name>
          </person-group>
          <article-title>Beneficial health effects of lupeol triterpene: a review of preclinical studies</article-title>.
          <source>Life Sci</source>.
          <year>2011</year>;<volume>88</volume>(<issue>7–8</issue>):<fpage>285</fpage>–<lpage>293</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.lfs.2010.11.020</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R3">
        <label>3</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Hanahan</surname><given-names>D</given-names></name>
          </person-group>
          <article-title>Hallmarks of cancer: new dimensions</article-title>.
          <source>Cancer Discov</source>.
          <year>2022</year>;<volume>12</volume>(<issue>1</issue>):<fpage>31</fpage>–<lpage>46</lpage>.
          <pub-id pub-id-type="doi">10.1158/2159-8290.CD-21-1059</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R4">
        <label>4</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Siegel</surname><given-names>RL</given-names></name>
            <name><surname>Miller</surname><given-names>KD</given-names></name>
            <name><surname>Fuchs</surname><given-names>HE</given-names></name>
            <name><surname>Jemal</surname><given-names>A</given-names></name>
          </person-group>
          <article-title>Cancer statistics, 2022</article-title>.
          <source>CA Cancer J Clin</source>.
          <year>2022</year>;<volume>72</volume>(<issue>1</issue>):<fpage>7</fpage>–<lpage>33</lpage>.
          <pub-id pub-id-type="doi">10.3322/caac.21708</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R5">
        <label>5</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Malekinejad</surname><given-names>F</given-names></name>
            <name><surname>Kheradmand</surname><given-names>F</given-names></name>
            <name><surname>Khadem-Ansari</surname><given-names>MH</given-names></name>
            <name><surname>Malekinejad</surname><given-names>H</given-names></name>
          </person-group>
          <article-title>Lupeol synergizes with doxorubicin to induce anti-proliferative and apoptotic effects on breast cancer cells</article-title>.
          <source>DARU, J Pharm Sci</source>.
          <year>2022</year>;<volume>30</volume>(<issue>1</issue>):<fpage>103</fpage>–<lpage>115</lpage>.
          <pub-id pub-id-type="doi">10.1007/s40199-022-00436-w</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R6">
        <label>6</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Fatma</surname><given-names>H</given-names></name>
            <name><surname>Jameel</surname><given-names>M</given-names></name>
            <name><surname>Siddiqui</surname><given-names>AJ</given-names></name>
            <name><surname>Kuddus</surname><given-names>M</given-names></name>
            <name><surname>Buali</surname><given-names>NS</given-names></name>
            <name><surname>Bahrini</surname><given-names>I</given-names></name>
            <etal/>
          </person-group>
          <article-title>Chemotherapeutic Potential of Lupeol Against Cancer in Pre-Clinical Model: A Systematic Review and Meta-Analysis</article-title>.
          <source>Phytomedicine</source>.
          <year>2024</year>:<fpage>155777</fpage>.
          <pub-id pub-id-type="doi">10.1016/j.phymed.2024.155777</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R7">
        <label>7</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Pitchai</surname><given-names>D</given-names></name>
            <name><surname>Roy</surname><given-names>A</given-names></name>
            <name><surname>Ignatius</surname><given-names>C</given-names></name>
          </person-group>
          <article-title>In vitro evaluation of anticancer potentials of lupeol isolated from Elephantopus scaber L. on MCF-7 cell line</article-title>.
          <source>J Adv Pharm Technol Res</source>.
          <year>2014</year>;<volume>5</volume>(<issue>4</issue>):<fpage>179</fpage>–<lpage>184</lpage>.
          <pub-id pub-id-type="doi">10.4103/2231-4040.143037</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R8">
        <label>8</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Prasad</surname><given-names>S</given-names></name>
            <name><surname>Nigam</surname><given-names>N</given-names></name>
            <name><surname>Kalra</surname><given-names>N</given-names></name>
            <name><surname>Shukla</surname><given-names>Y</given-names></name>
          </person-group>
          <article-title>Regulation of signaling pathways involved in lupeol induced inhibition of proliferation and induction of apoptosis in human prostate cancer cells</article-title>.
          <source>Mol Carcinog</source>.
          <year>2008</year>;<volume>47</volume>(<issue>12</issue>):<fpage>916</fpage>–<lpage>924</lpage>.
          <pub-id pub-id-type="doi">10.1002/mc.20442</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R9">
        <label>9</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Siddique</surname><given-names>HR</given-names></name>
            <name><surname>Mishra</surname><given-names>SK</given-names></name>
            <name><surname>Karnes</surname><given-names>RJ</given-names></name>
            <name><surname>Saleem</surname><given-names>M</given-names></name>
          </person-group>
          <article-title>Lupeol, a novel androgen receptor inhibitor: implications in prostate cancer therapy</article-title>.
          <source>Clin Cancer Res</source>.
          <year>2011</year>;<volume>17</volume>(<issue>16</issue>):<fpage>5379</fpage>–<lpage>5391</lpage>.
          <pub-id pub-id-type="doi">10.1158/1078-0432.CCR-11-0916</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R10">
        <label>10</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Liu</surname><given-names>K</given-names></name>
            <name><surname>Zhang</surname><given-names>X</given-names></name>
            <name><surname>Xie</surname><given-names>L</given-names></name>
            <name><surname>Deng</surname><given-names>M</given-names></name>
            <name><surname>Chen</surname><given-names>H</given-names></name>
            <name><surname>Song</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>
          <article-title>Lupeol and its derivatives as anticancer and anti-inflammatory agents: Molecular mechanisms and therapeutic efficacy</article-title>.
          <source>Pharmacol Res</source>.
          <year>2021</year>;<volume>164</volume>:<fpage>105373</fpage>.
          <pub-id pub-id-type="doi">10.1016/j.phrs.2020.105373</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R13">
        <label>13</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Welboren</surname><given-names>W-J</given-names></name>
            <name><surname>Sweep</surname><given-names>FCGJ</given-names></name>
            <name><surname>Span</surname><given-names>PN</given-names></name>
            <name><surname>Stunnenberg</surname><given-names>HG</given-names></name>
          </person-group>
          <article-title>Genomic actions of estrogen receptor?: what are the targets and how are they regulated?</article-title>
          <source>Endocr Relat Cancer</source>.
          <year>2009</year>;<volume>16</volume>(<issue>4</issue>):<fpage>1073</fpage>.
          <pub-id pub-id-type="doi">10.1677/ERC-09-0086</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R14">
        <label>14</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Clusan</surname><given-names>L</given-names></name>
            <name><surname>Le Goff</surname><given-names>P</given-names></name>
            <name><surname>Flouriot</surname><given-names>G</given-names></name>
            <name><surname>Pakdel</surname><given-names>F</given-names></name>
          </person-group>
          <article-title>A closer look at estrogen receptor mutations in breast cancer and their implications for estrogen and antiestrogen responses</article-title>.
          <source>Int J Mol Sci</source>.
          <year>2021</year>;<volume>22</volume>(<issue>2</issue>):<fpage>756</fpage>.
          <pub-id pub-id-type="doi">10.3390/ijms22020756</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R15">
        <label>15</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Gruvberger</surname><given-names>S</given-names></name>
          </person-group>
          <article-title>Estrogen receptor alpha and beta in breast cancer-gene expression profiles and clinical implications</article-title>.
          <source>Department of Oncology, Clinical Sciences, Lund University</source>;
          <year>2005</year>. p. <fpage>96</fpage>.
          <pub-id pub-id-type="doi">10.1016/j.ejso.2004.02.010</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R16">
        <label>16</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Sung</surname><given-names>H</given-names></name>
            <name><surname>Ferlay</surname><given-names>J</given-names></name>
            <name><surname>Siegel</surname><given-names>RL</given-names></name>
            <name><surname>Laversanne</surname><given-names>M</given-names></name>
            <name><surname>Soerjomataram</surname><given-names>I</given-names></name>
            <name><surname>Jemal</surname><given-names>A</given-names></name>
            <etal/>
          </person-group>
          <article-title>Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries</article-title>.
          <source>CA Cancer J Clin</source>.
          <year>2021</year>;<volume>71</volume>(<issue>3</issue>):<fpage>209</fpage>–<lpage>249</lpage>.
          <pub-id pub-id-type="doi">10.3322/caac.21660</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R17">
        <label>17</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Kim</surname><given-names>TJ</given-names></name>
            <name><surname>Lee</surname><given-names>YH</given-names></name>
            <name><surname>Koo</surname><given-names>KC</given-names></name>
          </person-group>
          <article-title>Current status and future perspectives of androgen receptor inhibition therapy for prostate cancer: a comprehensive review</article-title>.
          <source>Biomolecules</source>.
          <year>2021</year>;<volume>11</volume>(<issue>4</issue>):<fpage>492</fpage>.
          <pub-id pub-id-type="doi">10.3390/biom11040492</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R18">
        <label>18</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Amini</surname><given-names>P</given-names></name>
            <name><surname>Moazamiyanfar</surname><given-names>R</given-names></name>
            <name><surname>Dakkali</surname><given-names>MS</given-names></name>
            <name><surname>Khani</surname><given-names>A</given-names></name>
            <name><surname>Jafarzadeh</surname><given-names>E</given-names></name>
            <name><surname>Mouludi</surname><given-names>K</given-names></name>
            <etal/>
          </person-group>
          <article-title>Resveratrol in cancer therapy: from stimulation of genomic stability to adjuvant cancer therapy: a comprehensive review</article-title>.
          <source>Curr Top Med Chem</source>.
          <year>2023</year>;<volume>23</volume>(<issue>8</issue>):<fpage>629</fpage>–<lpage>648</lpage>.
          <pub-id pub-id-type="doi">10.2174/1568026623666221014152759</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R19">
        <label>19</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Ahmed</surname><given-names>M</given-names></name>
            <name><surname>Khan</surname><given-names>MI</given-names></name>
            <name><surname>Khan</surname><given-names>MR</given-names></name>
            <name><surname>Muhammad</surname><given-names>N</given-names></name>
            <name><surname>Khan</surname><given-names>AU</given-names></name>
            <name><surname>Khan</surname><given-names>RA</given-names></name>
          </person-group>
          <article-title>Role of medicinal plants in oxidative stress and cancer</article-title>.
          <source>Sci Rep</source>.
          <year>2013</year>;<volume>2</volume>(<issue>1</issue>):<fpage>641</fpage>–<lpage>644</lpage>.
          <pub-id pub-id-type="doi">10.4172/scientificreports.641</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R20">
        <label>20</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Amini</surname><given-names>P</given-names></name>
            <name><surname>Moazamiyanfar</surname><given-names>R</given-names></name>
            <name><surname>Dakkali</surname><given-names>MS</given-names></name>
            <name><surname>Jafarzadeh</surname><given-names>E</given-names></name>
            <name><surname>Ganjizadeh</surname><given-names>M</given-names></name>
            <name><surname>Rastegar-Pouyani</surname><given-names>N</given-names></name>
            <etal/>
          </person-group>
          <article-title>Induction of cancer cell death by apigenin: a review on different cell death pathways</article-title>.
          <source>Mini Rev Med Chem</source>.
          <year>2023</year>;<volume>23</volume>(<issue>14</issue>):<fpage>1461</fpage>–<lpage>1478</lpage>.
          <pub-id pub-id-type="doi">10.2174/1389557523666230119110744</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R21">
        <label>21</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <collab>ECACC</collab>
          </person-group>
          <article-title>Fundamental Techniques in Cell Culture</article-title>.
          <source>SIGMA Lab</source>.
          <year>2008</year>;<fpage>1</fpage>–<lpage>61</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R22">
        <label>22</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Kamiloğlu Beştepe</surname><given-names>S</given-names></name>
            <name><surname>Sarı</surname><given-names>G</given-names></name>
            <name><surname>Özdal</surname><given-names>T</given-names></name>
            <name><surname>Çapanoğlu Güven</surname><given-names>E</given-names></name>
          </person-group>
          <article-title>Guidelines for cell viability assays</article-title>.
          <source>FOOD Front</source>.
          <year>2020</year>;<volume>1</volume>(<issue>3</issue>).
          <pub-id pub-id-type="doi">10.1002/fft2.44</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R23">
        <label>23</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Varasteh</surname><given-names>S</given-names></name>
            <name><surname>Braber</surname><given-names>S</given-names></name>
            <name><surname>Kraneveld</surname><given-names>AD</given-names></name>
            <name><surname>Garssen</surname><given-names>J</given-names></name>
            <name><surname>Fink-Gremmels</surname><given-names>J</given-names></name>
          </person-group>
          <article-title>l-Arginine supplementation prevents intestinal epithelial barrier breakdown under heat stress conditions by promoting nitric oxide synthesis</article-title>.
          <source>Nutr Res</source>.
          <year>2018</year> <month>Sep</month>;<volume>57</volume>:<fpage>45</fpage>–<lpage>55</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.nutres.2018.05.007</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R24">
        <label>24</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Koracevic</surname><given-names>D</given-names></name>
            <name><surname>Koracevic</surname><given-names>G</given-names></name>
            <name><surname>Djordjevic</surname><given-names>V</given-names></name>
            <name><surname>Andrejevic</surname><given-names>S</given-names></name>
            <name><surname>Cosic</surname><given-names>V</given-names></name>
          </person-group>
          <article-title>Method for the measurement of antioxidant activity in human fluids</article-title>.
          <source>J Clin Pathol</source>.
          <year>2001</year>;<volume>54</volume>(<issue>5</issue>):<fpage>356</fpage>–<lpage>361</lpage>.
          <pub-id pub-id-type="doi">10.1136/jcp.54.5.356</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R25">
        <label>25</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Chomczynski</surname><given-names>P</given-names></name>
            <name><surname>Sacchi</surname><given-names>N</given-names></name>
          </person-group>
          <article-title>The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on</article-title>.
          <source>Nat Protoc</source>.
          <year>2006</year>;<volume>1</volume>(<issue>2</issue>):<fpage>581</fpage>–<lpage>585</lpage>.
          <pub-id pub-id-type="doi">10.1038/nprot.2006.83</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R26">
        <label>26</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Harbeck</surname><given-names>N</given-names></name>
            <name><surname>Penault-Llorca</surname><given-names>F</given-names></name>
            <name><surname>Cortes</surname><given-names>J</given-names></name>
            <name><surname>Gnant</surname><given-names>M</given-names></name>
            <name><surname>Houssami</surname><given-names>N</given-names></name>
            <name><surname>Poortmans</surname><given-names>P</given-names></name>
            <etal/>
          </person-group>
          <article-title>Breast cancer</article-title>.
          <source>Nature Reviews Disease Primers</source>.
          <year>2019</year>;<volume>5</volume>.
          <pub-id pub-id-type="doi">10.1038/s41572-019-0111-2</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R27">
        <label>27</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Lawhn-Heath</surname><given-names>C</given-names></name>
            <name><surname>Salavati</surname><given-names>A</given-names></name>
            <name><surname>Behr</surname><given-names>SC</given-names></name>
            <name><surname>Rowe</surname><given-names>SP</given-names></name>
            <name><surname>Calais</surname><given-names>J</given-names></name>
            <name><surname>Fendler</surname><given-names>WP</given-names></name>
            <etal/>
          </person-group>
          <article-title>Prostate-specific Membrane Antigen PET in Prostate Cancer</article-title>.
          <source>Radiology</source>.
          <year>2021</year> <month>May</month>;<volume>299</volume>(<issue>2</issue>):<fpage>248</fpage>–<lpage>260</lpage>.
          <pub-id pub-id-type="doi">10.1148/radiol.2021202771</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R28">
        <label>28</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Barbieri</surname><given-names>CE</given-names></name>
            <name><surname>Tomlins</surname><given-names>SA</given-names></name>
          </person-group>
          <article-title>The prostate cancer genome: Perspectives and potential</article-title>.
          <source>Urol Oncol Semin Orig Investig</source>.
          <year>2014</year>;<volume>32</volume>(<issue>1</issue>):<fpage>53.e15</fpage>-<lpage>53.e22</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.urolonc.2013.08.025</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R29">
        <label>29</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Sloan</surname><given-names>M</given-names></name>
            <name><surname>Cancer</surname><given-names>K</given-names></name>
            <name><surname>City</surname><given-names>NY</given-names></name>
            <name><surname>City</surname><given-names>NY</given-names></name>
          </person-group>
          <article-title>Estrogen Receptor-Positive Breast Cancer : Exploiting Signaling Pathways Implicated in Endocrine Resistance</article-title>.
          <year>2018</year>;<fpage>528</fpage>–<lpage>539</lpage>.
          <pub-id pub-id-type="doi">10.1634/theoncologist.2017-0423</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R30">
        <label>30</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Martins</surname><given-names>WK</given-names></name>
            <name><surname>Costa</surname><given-names>ÉT</given-names></name>
            <name><surname>Cruz</surname><given-names>MC</given-names></name>
            <name><surname>Stolf</surname><given-names>BS</given-names></name>
            <name><surname>Miotto</surname><given-names>R</given-names></name>
            <name><surname>Cordeiro</surname><given-names>RM</given-names></name>
            <etal/>
          </person-group>
          <article-title>Parallel damage in mitochondrial and lysosomal compartments promotes efficient cell death with autophagy : The case of the pentacyclic triterpenoids</article-title>.
          <source>Nat Publ Gr</source>.
          <year>2015</year> <month>June</month>:<fpage>1</fpage>–<lpage>17</lpage>.
          <pub-id pub-id-type="doi">10.1038/srep12425</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R31">
        <label>31</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Santiago</surname><given-names>LA</given-names></name>
            <name><surname>Mayor</surname><given-names>ABR</given-names></name>
          </person-group>
          <article-title>L upeol : A n antioxidant triterpene in F icus pseudopalma B lanco</article-title>.
          <source>Asian Pac J Trop Biomed</source>.
          <year>2014</year>;<volume>4</volume>(<issue>2</issue>):<fpage>109</fpage>–<lpage>118</lpage>.
          <pub-id pub-id-type="doi">10.1016/S2221-1691(14)60218-5</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R32">
        <label>32</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Extract</surname><given-names>L</given-names></name>
            <name><surname>Crateva</surname><given-names>OF</given-names></name>
            <name><surname>Oliv</surname><given-names>A</given-names></name>
            <name><surname>Tchimene</surname><given-names>MK</given-names></name>
            <name><surname>Nwaehujor</surname><given-names>CO</given-names></name>
            <name><surname>Ezenwali</surname><given-names>M</given-names></name>
            <etal/>
          </person-group>
          <article-title>Free Radical Scavenging Activity of Lupeol Isolated from the Methanol Leaf Extract of Crateva adansonii Oliv . (Capparidaceae)</article-title>.
          <source>International Journal of Pharmacognosy and Phytochemical Research</source>.
          <year>2016</year>; <volume>8</volume>(<issue>3</issue>); <fpage>419</fpage>-<lpage>426</lpage>.
        </mixed-citation>
      </ref>
      <ref id="R33">
        <label>33</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Pérez-González</surname><given-names>MZ</given-names></name>
            <name><surname>Nieto-Trujillo</surname><given-names>A</given-names></name>
            <name><surname>Gutiérrez-Rebolledo</surname><given-names>GA</given-names></name>
            <name><surname>García-Martínez</surname><given-names>I</given-names></name>
            <name><surname>Estrada-Zúñiga</surname><given-names>ME</given-names></name>
            <name><surname>Bernabé-Antonio</surname><given-names>A</given-names></name>
            <etal/>
          </person-group>
          <article-title>Lupeol acetate production and antioxidant activity of a cell suspension culture from Cnidoscolus chayamansa leaves</article-title>.
          <source>South African J Bot</source>.
          <year>2019</year>;<volume>125</volume>:<fpage>30</fpage>–<lpage>38</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.sajb.2019.06.030</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R34">
        <label>34</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Qin</surname><given-names>A</given-names></name>
            <name><surname>Qin</surname><given-names>J</given-names></name>
            <name><surname>Jin</surname><given-names>Y</given-names></name>
            <name><surname>Xie</surname><given-names>W</given-names></name>
            <name><surname>Fan</surname><given-names>L</given-names></name>
            <name><surname>Jiang</surname><given-names>L</given-names></name>
            <etal/>
          </person-group>
          <article-title>DHEA improves the antioxidant capacity of endometrial stromal cells and improves endometrium receptivity via androgen receptor</article-title>.
          <source>Eur J Obstet Gynecol Reprod Biol</source>.
          <year>2016</year>;<volume>198</volume>:<fpage>120</fpage>–<lpage>126</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.ejogrb.2016.01.016</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R35">
        <label>35</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Jin</surname><given-names>LY</given-names></name>
            <name><surname>Lv</surname><given-names>ZD</given-names></name>
            <name><surname>Wang</surname><given-names>K</given-names></name>
            <name><surname>Qian</surname><given-names>L</given-names></name>
            <name><surname>Song</surname><given-names>XX</given-names></name>
            <name><surname>Li</surname><given-names>XF</given-names></name>
            <etal/>
          </person-group>
          <article-title>Estradiol alleviates intervertebral disc degeneration through modulating the antioxidant enzymes and inhibiting autophagy in the model of menopause rats</article-title>.
          <source>Oxid Med Cell Longev</source>.
          <year>2018</year>;<volume>2018</volume>:<fpage>7890291</fpage>.
          <pub-id pub-id-type="doi">10.1155/2018/7890291</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R36">
        <label>36</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Ding</surname><given-names>X</given-names></name>
            <name><surname>Yu</surname><given-names>L</given-names></name>
            <name><surname>Ge</surname><given-names>C</given-names></name>
            <name><surname>Ma</surname><given-names>H</given-names></name>
          </person-group>
          <article-title>Protective effect of DHEA on hydrogen peroxide-induced oxidative damage and apoptosis in primary rat Leydig cells</article-title>.
          <year>2017</year>;<volume>8</volume>(<issue>10</issue>):<fpage>16158</fpage>–<lpage>16169</lpage>.
          <pub-id pub-id-type="doi">10.18632/oncotarget.15300</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R37">
        <label>37</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Son</surname><given-names>HJ</given-names></name>
            <name><surname>Kim</surname><given-names>N</given-names></name>
            <name><surname>Song</surname><given-names>C</given-names></name>
            <name><surname>Lee</surname><given-names>SM</given-names></name>
            <name><surname>Lee</surname><given-names>H</given-names></name>
            <name><surname>Surh</surname><given-names>Y</given-names></name>
          </person-group>
          <article-title>17 β -Estradiol reduces inflammation and modulates antioxidant enzymes in colonic epithelial cells</article-title>.
          <source>The Korean Journal of Internal Medicine</source>.
          <year>2020</year> <month>Mar</month>;<volume>35</volume>(<issue>2</issue>):<fpage>310</fpage>.
          <pub-id pub-id-type="doi">10.3904/kjim.2018.098</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R38">
        <label>38</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Gorrini</surname><given-names>C</given-names></name>
            <name><surname>Gang</surname><given-names>BP</given-names></name>
            <name><surname>Bassi</surname><given-names>C</given-names></name>
            <name><surname>Wakeham</surname><given-names>A</given-names></name>
            <name><surname>Pegah</surname><given-names>S</given-names></name>
            <name><surname>Hao</surname><given-names>Z</given-names></name>
            <etal/>
          </person-group>
          <article-title>Estrogen controls the survival of BRCA1-deficient cells via a PI3K – NRF2-regulated pathway</article-title>.
          <source>Proceedings of the National Academy of Sciences</source>.
          <year>2014</year> <month>Mar</month> <day>25</day>;<volume>111</volume>(<issue>12</issue>):<fpage>4472</fpage>-<lpage>4477</lpage>.
          <pub-id pub-id-type="doi">10.1073/pnas.1324136111</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R39">
        <label>39</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Abiramasundari</surname><given-names>G</given-names></name>
            <name><surname>Mohan Gowda</surname><given-names>CM</given-names></name>
            <name><surname>Sreepriya</surname><given-names>M</given-names></name>
          </person-group>
          <article-title>Selective Estrogen Receptor Modulator and prostimulatory effects of phytoestrogen β-ecdysone in Tinospora cordifolia on osteoblast cells</article-title>.
          <source>J Ayurveda Integr Med</source>.
          <year>2018</year>;<volume>9</volume>(<issue>3</issue>):<fpage>161</fpage>–<lpage>168</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.jaim.2017.04.003</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R40">
        <label>40</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Wardell</surname><given-names>SE</given-names></name>
            <name><surname>Nelson</surname><given-names>ER</given-names></name>
            <name><surname>McDonnell</surname><given-names>DP</given-names></name>
          </person-group>
          <article-title>From empirical to mechanism-based discovery of clinically useful Selective Estrogen Receptor Modulators (SERMs)</article-title>.
          <source>Steroids</source>.
          <year>2014</year>;<volume>90</volume>:<fpage>30</fpage>–<lpage>38</lpage>.
          <pub-id pub-id-type="doi">10.1016/j.steroids.2014.07.013</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R41">
        <label>41</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Thongon</surname><given-names>N</given-names></name>
            <name><surname>Boonmuen</surname><given-names>N</given-names></name>
            <name><surname>Suksen</surname><given-names>K</given-names></name>
            <name><surname>Wichit</surname><given-names>P</given-names></name>
            <name><surname>Chairoungdua</surname><given-names>A</given-names></name>
            <name><surname>Tuchinda</surname><given-names>P</given-names></name>
            <etal/>
          </person-group>
          <article-title>Selective Estrogen Receptor Modulator (SERM)-like Activities of Diarylheptanoid, a Phytoestrogen from Curcuma comosa, in Breast Cancer Cells, Pre-osteoblast Cells, and Rat Uterine Tissues</article-title>.
          <source>J Agric Food Chem</source>.
          <year>2017</year>;<volume>65</volume>(<issue>17</issue>):<fpage>3490</fpage>–<lpage>3496</lpage>.
          <pub-id pub-id-type="doi">10.2174/1871520620666200424131548</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R42">
        <label>42</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Zingue</surname><given-names>S</given-names></name>
            <name><surname>Ntsa</surname><given-names>DM</given-names></name>
            <name><surname>Magne Nde</surname><given-names>CB</given-names></name>
            <name><surname>Michel</surname><given-names>T</given-names></name>
            <name><surname>Ndinteh</surname><given-names>DT</given-names></name>
            <name><surname>Clyne</surname><given-names>C</given-names></name>
            <etal/>
          </person-group>
          <article-title>Lupeol, the major compound of the dichloromethane extract of Millettia macrophylla Benth (Fabaceae), displays estrogenic effects in ovariectomized rats</article-title>.
          <source>Phyther Res</source>.
          <year>2019</year>;<volume>33</volume>(<issue>4</issue>):<fpage>949</fpage>–<lpage>957</lpage>.
          <pub-id pub-id-type="doi">10.1002/ptr.6288</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R43">
        <label>43</label>
        <mixed-citation publication-type="book">
          <person-group person-group-type="author">
            <name><surname>Clark</surname><given-names>BJ</given-names></name>
            <name><surname>Prough</surname><given-names>RA</given-names></name>
            <name><surname>Klinge</surname><given-names>CM</given-names></name>
          </person-group>
          <chapter-title>Mechanisms of Action of Dehydroepiandrosterone</chapter-title>.
          <source>Vitamins and Hormones</source>. <volume>108</volume>,
          <publisher-name>Elsevier Inc</publisher-name>.;
          <year>2018</year>. p. <fpage>29</fpage>–<lpage>73</lpage>.
          <pub-id pub-id-type="doi">10.1016/bs.vh.2018.02.003</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R44">
        <label>44</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Capellino</surname><given-names>S</given-names></name>
            <name><surname>Straub</surname><given-names>RH</given-names></name>
            <name><surname>Cutolo</surname><given-names>M</given-names></name>
          </person-group>
          <article-title>Aromatase and regulation of the estrogen-to-androgen ratio in synovial tissue inflammation : common pathway in both sexes</article-title>.
          <year>2014</year>:<fpage>24</fpage>–<lpage>31</lpage>.
          <pub-id pub-id-type="doi">10.1111/nyas.12398</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R45">
        <label>45</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Khan</surname><given-names>MA</given-names></name>
            <name><surname>Singh</surname><given-names>D</given-names></name>
            <name><surname>Fatma</surname><given-names>H</given-names></name>
            <name><surname>Akhtar</surname><given-names>K</given-names></name>
            <name><surname>Arjmand</surname><given-names>F</given-names></name>
            <name><surname>Maurya</surname><given-names>S</given-names></name>
            <etal/>
          </person-group>
          <article-title>Antiandrogen enzalutamide induced genetic, cellular, and hepatic damages: amelioration by triterpene Lupeol</article-title>.
          <source>Drug Chem Toxicol</source>.
          <year>2022</year>:<fpage>1</fpage>–<lpage>12</lpage>.
          <pub-id pub-id-type="doi">10.1080/01480545.2022.2040528</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R46">
        <label>46</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Bhatt</surname><given-names>M</given-names></name>
            <name><surname>Patel</surname><given-names>M</given-names></name>
            <name><surname>Adnan</surname><given-names>M</given-names></name>
            <name><surname>Reddy</surname><given-names>MN</given-names></name>
          </person-group>
          <article-title>Anti-metastatic effects of lupeol via the inhibition of MAPK/ERK pathway in lung cancer</article-title>.
          <source>Anti-Cancer Agents Med Chem (Formerly Curr Med Chem Agents)</source>.
          <year>2021</year>;<volume>21</volume>(<issue>2</issue>):<fpage>201</fpage>–<lpage>206</lpage>.
          <pub-id pub-id-type="doi">10.2174/1871520620666200424131548</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R47">
        <label>47</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Saleem</surname><given-names>M</given-names></name>
            <name><surname>Murtaza</surname><given-names>I</given-names></name>
            <name><surname>Tarapore</surname><given-names>RS</given-names></name>
            <name><surname>Suh</surname><given-names>Y</given-names></name>
            <name><surname>Adhami</surname><given-names>VM</given-names></name>
            <name><surname>Johnson</surname><given-names>JJ</given-names></name>
            <etal/>
          </person-group>
          <article-title>Lupeol inhibits proliferation of human prostate cancer cells by targeting β-catenin signaling</article-title>.
          <source>Carcinogenesis</source>.
          <year>2009</year>;<volume>30</volume>(<issue>5</issue>):<fpage>808</fpage>–<lpage>817</lpage>.
          <pub-id pub-id-type="doi">10.1093/carcin/bgp044</pub-id>.
        </mixed-citation>
      </ref>
      <ref id="R48">
        <label>48</label>
        <mixed-citation publication-type="journal">
          <person-group person-group-type="author">
            <name><surname>Zhang</surname><given-names>X</given-names></name>
            <name><surname>Gao</surname><given-names>Z</given-names></name>
            <name><surname>Chen</surname><given-names>K</given-names></name>
            <name><surname>Zhuo</surname><given-names>Q</given-names></name>
            <name><surname>Chen</surname><given-names>M</given-names></name>
            <name><surname>Wang</surname><given-names>J</given-names></name>
            <etal/>
          </person-group>
          <article-title>Lupeol inhibits the proliferation and migration of MDA-MB-231 breast cancer cells via a novel crosstalk mechanism between autophagy and the EMT</article-title>.
          <source>Food Funct</source>.
          <year>2022</year>;<volume>13</volume>(<issue>9</issue>):<fpage>4967</fpage>–<lpage>4976</lpage>.
          <pub-id pub-id-type="doi">10.1039/D2FO00483F</pub-id>.
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>


